Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9726
Trapped Gene
Akap12 (ENSMUSG00000038587)
Vector Insertion
Chr 10: 5988064 - 5991158
Public Clones XG087 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000577421 (Chr10:5991159..5991350 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCAGGAGAGATCAATGAGG Chr10:5991210..5991229 59.76 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000577421 (Chr10:5991159..5991350 -)
Downstram Exon
ENSMUSE00000515563 (Chr10:5987073..5988063 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCAGGAGAGATCAATGAGG Chr10:5991210..5991229 59.76 55 TTTGGTCTCAAGGTCCCAAC Chr10:5987969..5987988 59.94 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000491803 Chr10:6079873..6080178 ACCCCTTAGTCCCTGTGGTC Chr10:6080107..6080126 60.23 60
upstream ENSMUSE00000490750 Chr10:6032684..6032798 AGATGTCCACGTCCAAGAGG Chr10:6032726..6032745 60.11 55
upstream ENSMUSE00000577414 Chr10:5991352..5993399 GTGAGCTGAAGCAATCCACA Chr10:5992999..5993018 59.99 50
upstream ENSMUSE00000577421 Chr10:5991159..5991350 GCCAGGAGAGATCAATGAGG Chr10:5991210..5991229 59.76 55
upstream ENSMUSE00000519058 Chr10:5988602..5993399 AGACACTCCAAACGGGACAC Chr10:5990202..5990221 60.01 55

*** Putative Vector Insertion (Chr 10: 5988064 - 5991158) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000515563 Chr10:5987073..5988063 TTTGGTCTCAAGGTCCCAAC Chr10:5987969..5987988 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTCTTGGGCAGTTATCCT Chr10:5991123..5991143 60.6 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAATGACGTGACTGGGAAAA Chr10:5991093..5991113 59.54 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038587