Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9745
Trapped Gene
Grit (ENSMUSG00000041444)
Vector Insertion
Chr 9: 32061724 - 32062758
Public Clones XG279 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000260879 (Chr9:32061652..32061723 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCTCTCCATGCAGTTGACG Chr9:32061704..32061723 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000260879 (Chr9:32061652..32061723 +)
Downstram Exon
ENSMUSE00000260854 (Chr9:32062759..32063643 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCTCTCCATGCAGTTGACG Chr9:32061704..32061723 59.98 50 GGGGCAGATTGTCATAGGAA Chr9:32062875..32062894 59.89 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000430641 Chr9:32015785..32015850 ACCAACTCAGTGCCAAAACC Chr9:32015829..32015848 60.01 50
upstream ENSMUSE00000390751 Chr9:32046847..32046996 AGCACGGCAAGCTCATTACT Chr9:32046856..32046875 60.04 50
upstream ENSMUSE00000261059 Chr9:32052737..32052839 GCGTTCATCGAGAGGTATGG Chr9:32052763..32052782 60.62 55
upstream ENSMUSE00000261045 Chr9:32053503..32053647 CCAAACCCTCTGCTCACCTA Chr9:32053606..32053625 60.25 55
upstream ENSMUSE00000261021 Chr9:32054032..32054114 AACGGATGAAGAACGGTTGA Chr9:32054049..32054068 60.49 45
upstream ENSMUSE00000375168 Chr9:32054693..32054800 TATGCATGCGAAAAACCTTG Chr9:32054753..32054772 59.7 40
upstream ENSMUSE00000260939 Chr9:32055071..32055216 AGTGGGACAGCAGCTTTCAT Chr9:32055099..32055118 59.87 50
upstream ENSMUSE00000260921 Chr9:32055965..32056160 CTTCTCTGTCAAGGCCCAAG Chr9:32055965..32055984 59.98 55
upstream ENSMUSE00000260902 Chr9:32058227..32058372 GCAAGTTGCAGCGTAATGAA Chr9:32058316..32058335 60.02 45
upstream ENSMUSE00000260879 Chr9:32061652..32061723 TTCTCTCCATGCAGTTGACG Chr9:32061704..32061723 59.98 50

*** Putative Vector Insertion (Chr 9: 32061724 - 32062758) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000260854 Chr9:32062759..32063643 GGGGCAGATTGTCATAGGAA Chr9:32062875..32062894 59.89 50
downstream ENSMUSE00000260823 Chr9:32064298..32065283 GGTGGGGTTTATCCACACTG Chr9:32064948..32064967 60.09 55
downstream ENSMUSE00000413669 Chr9:32066487..32068869 CATCAGGCCTAGCAAAGGAG Chr9:32066916..32066935 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCATGCAGTTGACGGTAAGA Chr9:32061711..32061731 59.72 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATGCAGTTGACGGTAAGA Chr9:32061711..32061731 59.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041444