Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9750
Trapped Gene
Acbd5 (ENSMUSG00000026781)
Vector Insertion
Chr 2: 22945109 - 22945157
Public Clones XG366 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000699679 (Chr2:22945110..22945308 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCATTGTCTGTGCTCACCA Chr2:22945287..22945306 60.16 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000699679 (Chr2:22945110..22945308 +)
Downstram Exon
ENSMUSE00000699646 (Chr2:22945111..22945156 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCATTGTCTGTGCTCACCA Chr2:22945287..22945306 60.16 50 TGCTGATTTCTTCAGCGTTT Chr2:22945139..22945158 58.65 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699659 Chr2:22923688..22923806 GTCGAGACAAAACGGACAGG Chr2:22923760..22923779 60.69 55
upstream ENSMUSE00000699654 Chr2:22923770..22923806 CCTTGCCAGTCATTTGGCTA Chr2:22923780..22923799 61.16 50
upstream ENSMUSE00000699668 Chr2:22924588..22924804 CAAGGCCTGCTGCTAGAGAT Chr2:22924772..22924791 59.74 55
upstream ENSMUSE00000699705 Chr2:22924599..22924804 CAAGGCCTGCTGCTAGAGAT Chr2:22924772..22924791 59.74 55
upstream ENSMUSE00000374754 Chr2:22924971..22925139 CCAGAGTTTGCCGAAAAATG Chr2:22925120..22925139 60.61 45
upstream ENSMUSE00000699658 Chr2:22924971..22925139 CCAGAGTTTGCCGAAAAATG Chr2:22925120..22925139 60.61 45
upstream ENSMUSE00000709654 Chr2:22931010..22931130 GGCAACTGAAGGACCCTGTA Chr2:22931065..22931084 60.11 55
upstream ENSMUSE00000719858 Chr2:22931010..22931130 GGCAACTGAAGGACCCTGTA Chr2:22931065..22931084 60.11 55
upstream ENSMUSE00000162672 Chr2:22933664..22933736 GCCATGATTGCATATGTTGAA Chr2:22933704..22933724 59.4 38.1
upstream ENSMUSE00000699651 Chr2:22933664..22933736 GCCATGATTGCATATGTTGAA Chr2:22933704..22933724 59.4 38.1
upstream ENSMUSE00000162678 Chr2:22935859..22935973 ATTGAAACCATGCCCATGAC Chr2:22935862..22935881 60.59 45
upstream ENSMUSE00000699648 Chr2:22935859..22935973 ATTGAAACCATGCCCATGAC Chr2:22935862..22935881 60.59 45
upstream ENSMUSE00000162682 Chr2:22943005..22943139 TGAAGAAGAAGAGGCCCAAG Chr2:22943084..22943103 59.54 50
upstream ENSMUSE00000699647 Chr2:22943005..22943139 TGAAGAAGAAGAGGCCCAAG Chr2:22943084..22943103 59.54 50
upstream ENSMUSE00000699683 Chr2:22943005..22943138 TGAAGAAGAAGAGGCCCAAG Chr2:22943084..22943103 59.54 50

*** Putative Vector Insertion (Chr 2: 22945109 - 22945157) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000699679 Chr2:22945110..22945308 GGTGAGCACAGACAATGGTG Chr2:22945308..22945327 60.16 55
downstream ENSMUSE00000162680 Chr2:22945111..22945308 TTGGTGAGCACAGACAATGG Chr2:22945310..22945329 60.72 50
downstream ENSMUSE00000699646 Chr2:22945111..22945156 TGCTGATTTCTTCAGCGTTT Chr2:22945139..22945158 58.65 40
downstream ENSMUSE00000162676 Chr2:22945996..22946102 TTCTTGTCCAAATTGCTCCA Chr2:22946102..22946121 59.25 40
downstream ENSMUSE00000270709 Chr2:22949809..22950037 TCACTTCGCCTTTTCCTTTG Chr2:22949941..22949960 60.36 45
downstream ENSMUSE00000699673 Chr2:22955082..22955284 GTCCTTCGCTCAAATGTGGT Chr2:22955117..22955136 60.12 50
downstream ENSMUSE00000270696 Chr2:22955085..22955284 GTCCTTCGCTCAAATGTGGT Chr2:22955117..22955136 60.12 50
downstream ENSMUSE00000270685 Chr2:22965765..22965806 GAGGGCTGATTACTTGTCTGC Chr2:22965801..22965821 58.95 52.38
downstream ENSMUSE00000331792 Chr2:22966174..22966283 ACAAATGTGCCAACCACTGA Chr2:22966267..22966286 60.01 45
downstream ENSMUSE00000699656 Chr2:22968025..22970030 AAGCGCAGTACAAGGACGAT Chr2:22968624..22968643 59.9 50
downstream ENSMUSE00000699660 Chr2:22968025..22970028 AAGCGCAGTACAAGGACGAT Chr2:22968624..22968643 59.9 50
downstream ENSMUSE00000699669 Chr2:22968025..22969935 AAGCGCAGTACAAGGACGAT Chr2:22968624..22968643 59.9 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAACGCTGAAGAAATCAGCA Chr2:22945118..22945138 58.65 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAACGCTGAAGAAATCAGCA Chr2:22945118..22945138 58.65 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026781