Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9779
Trapped Gene
Zfp273 (ENSMUSG00000030446)
Vector Insertion
Chr 13: 67923305 - 67924036
Public Clones XH655 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000570390 (Chr13:67923178..67923304 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTGGACTCTGCTCAGTGGA Chr13:67923234..67923253 59.69 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000570390 (Chr13:67923178..67923304 +)
Downstram Exon
ENSMUSE00000494938 (Chr13:67924037..67924132 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTGGACTCTGCTCAGTGGA Chr13:67923234..67923253 59.69 55 CCAGGTATGGCTTGGAGAAA Chr13:67924066..67924085 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000613394 Chr13:67914770..67914833 TCAAAGTTCGGACAGTGTGG Chr13:67914789..67914808 59.72 50
upstream ENSMUSE00000570390 Chr13:67923178..67923304 TCTGGACTCTGCTCAGTGGA Chr13:67923234..67923253 59.69 55

*** Putative Vector Insertion (Chr 13: 67923305 - 67924036) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000494938 Chr13:67924037..67924132 CCAGGTATGGCTTGGAGAAA Chr13:67924066..67924085 60.07 50
downstream ENSMUSE00000517030 Chr13:67925921..67927937 TCCTTCCCGAGTCATTATGC Chr13:67927520..67927539 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTGGGTGAGGATCACTTC Chr13:67923300..67923320 60.05 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTGGGTGAGGATCACTTC Chr13:67923300..67923320 60.05 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030446