Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9789
Trapped Gene
Dnajb6 (ENSMUSG00000029131)
Vector Insertion
Chr 5: 30062657 - 30074884
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
NPX320 (baygenomics) XH851 (baygenomics) P122H09 (ggtc) H004E06 (ggtc)
D042C04 (ggtc) (ggtc) P145E03 (ggtc) P150H08 (ggtc) P105H08 (ggtc)
E061A06 (ggtc) D007E04 (ggtc) P096F05 (ggtc) P145E03 (ggtc) H008E11 (ggtc)
D107C04 (ggtc) H008E11 (ggtc) P122H09 (ggtc) H001E12 (ggtc) D038D04 (ggtc)
(ggtc) P117B10 (ggtc) P150H08 (ggtc) P105H08 (ggtc) E061A06 (ggtc)
D007B11 (ggtc) P142E10 (ggtc) H008E11 (ggtc) D046C09 (ggtc) (ggtc)
D038D04 (ggtc) P117B10 (ggtc) H001E12 (ggtc) D026G01 (ggtc) (ggtc)
P068B11 (ggtc) P146G05 (ggtc) P096F05 (ggtc) D107C04 (ggtc) PST7739-NL (escells)
PST20454-NR (escells) PST10575-NR (escells) PST20391-NR (escells) PST14681-NR (escells)
PST7739-NR (escells) PST20065-NL (escells) IST14902A7 (tigm) IST15109H2 (tigm)
IST10948B1 (tigm) IST14180F4 (tigm) IST14240B8 (tigm) IST14234D7 (tigm)
IST14759E12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000185970 (Chr5:30062568..30062656 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000185970 (Chr5:30062568..30062656 +)
Downstram Exon
ENSMUSE00000710480 (Chr5:30074885..30074975 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CGCCCAGCACTTCATAGTAA Chr5:30074941..30074960 58.94 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700760 Chr5:30062480..30062656 TGACGCACTTCCTGTTTGTT Chr5:30062508..30062527 59.34 45
upstream ENSMUSE00000185970 Chr5:30062568..30062656 No primer for this exon

*** Putative Vector Insertion (Chr 5: 30062657 - 30074884) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000185974 Chr5:30074885..30074975 CGCCCAGCACTTCATAGTAA Chr5:30074941..30074960 58.94 50
downstream ENSMUSE00000710480 Chr5:30074885..30074975 CGCCCAGCACTTCATAGTAA Chr5:30074941..30074960 58.94 50
downstream ENSMUSE00000185969 Chr5:30077478..30077587 TTTGAACTTCCGCTCTGCTT Chr5:30077556..30077575 60.13 45
downstream ENSMUSE00000185979 Chr5:30078937..30078999 TCGTAGATGTCCCGCTTTTT Chr5:30078961..30078980 59.71 45
downstream ENSMUSE00000185975 Chr5:30080082..30080192 CGGAATGTGAAGCCAAACTC Chr5:30080130..30080149 60.64 50
downstream ENSMUSE00000185978 Chr5:30082774..30082878 TGCACGGTCACCTCATACAC Chr5:30082870..30082889 60.6 55
downstream ENSMUSE00000185980 Chr5:30084088..30084419 CCTCACTGTGCTCGTCACTC Chr5:30084195..30084214 59.6 60
downstream ENSMUSE00000185972 Chr5:30090939..30091070 GCAGGAAATCCACTTCCAAA Chr5:30091062..30091081 60.05 45
downstream ENSMUSE00000185973 Chr5:30092046..30092187 ATTTGAAGTTGCCCATTCCA Chr5:30092138..30092157 60.31 40
downstream ENSMUSE00000655112 Chr5:30092865..30092935 TTTCTTGACCGTTCTCCACA Chr5:30092890..30092909 59.26 45
downstream ENSMUSE00000700759 Chr5:30092865..30093643 GCGTAGCAGGTGCTCCTTAC Chr5:30092958..30092977 60.04 60
downstream ENSMUSE00000655109 Chr5:30107670..30107990 CCTGTCCTGCTCGTCATCTT Chr5:30107950..30107969 60.41 55
downstream ENSMUSE00000655108 Chr5:30111571..30111653 TCCTCTTGCCACCTTCTTTG Chr5:30111597..30111616 60.37 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTTCCAGGCAAATCCAGTA Chr5:30068645..30068665 60.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTTCCAGGCAAATCCAGTA Chr5:30068645..30068665 60.21 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029131