Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9793
Trapped Gene
Mea1 (ENSMUSG00000002768)
Vector Insertion
Chr 17: 46819061 - 46819667
Public Clones RRC019 (baygenomics) PST2868-NR (escells) PST7431-NR (escells) PST2868-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 71% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000136760 (Chr17:46818958..46819060 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000136760 (Chr17:46818958..46819060 +)
Downstram Exon
ENSMUSE00000424791 (Chr17:46819668..46820049 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000607108 Chr17:46818073..46818111 No primer for this exon
upstream ENSMUSE00000136758 Chr17:46818566..46818846 No primer for this exon
upstream ENSMUSE00000136760 Chr17:46818958..46819060 No primer for this exon

*** Putative Vector Insertion (Chr 17: 46819061 - 46819667) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000424791 Chr17:46819668..46820049 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCATGGACCCAGGTACAAAA Chr17:46819050..46819070 60.6 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATGGACCCAGGTACAAAA Chr17:46819050..46819070 60.6 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002768