Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9814
Trapped Gene
Pvrl2 (ENSMUSG00000062300)
Vector Insertion
Chr 7: 20310219 - 20315386
Public Clones XST131 (baygenomics) LST076 (baygenomics) PST093 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 73% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000198361 (Chr7:20315387..20315535 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTGTGGATCGAATGGTCAA Chr7:20315458..20315477 60.05 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000198361 (Chr7:20315387..20315535 -)
Downstram Exon
ENSMUSE00000676814 (Chr7:20309830..20310218 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTGTGGATCGAATGGTCAA Chr7:20315458..20315477 60.05 45 GATCCTCTGTCGCCATCATT Chr7:20310031..20310050 60.04 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000536242 Chr7:20334564..20334818 CCGATCGGTACACGAAGAGT Chr7:20334700..20334719 60.13 55
upstream ENSMUSE00000357931 Chr7:20323361..20323723 GGCAATTACACCTGCGAGTT Chr7:20323414..20323433 60.14 50
upstream ENSMUSE00000198358 Chr7:20318264..20318560 CCGAATCACCTGGATCTCAT Chr7:20318444..20318463 59.89 50
upstream ENSMUSE00000198353 Chr7:20315961..20316078 ATCCATCTCCGGCTATGATG Chr7:20316046..20316065 59.88 50
upstream ENSMUSE00000198361 Chr7:20315387..20315535 TCTGTGGATCGAATGGTCAA Chr7:20315458..20315477 60.05 45

*** Putative Vector Insertion (Chr 7: 20310219 - 20315386) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000676814 Chr7:20309830..20310218 GATCCTCTGTCGCCATCATT Chr7:20310031..20310050 60.04 50
downstream ENSMUSE00000198359 Chr7:20306702..20306855 GGCAGCGATAATACCTCCAA Chr7:20306772..20306791 60.06 50
downstream ENSMUSE00000198354 Chr7:20304782..20304845 No primer for this exon
downstream ENSMUSE00000198357 Chr7:20304545..20304631 CCCCAAGGTGAAGAGTTGAG Chr7:20304586..20304605 59.69 55
downstream ENSMUSE00000485480 Chr7:20302015..20303136 CAGATGCCCAGATTCTCCAT Chr7:20302047..20302066 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGAAGCCTTGTGGTGTTTG Chr7:20315362..20315382 60.15 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGAAGCCTTGTGGTGTTTG Chr7:20315362..20315382 60.15 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062300