Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9823
Trapped Gene
Igf2r (ENSMUSG00000023830)
Vector Insertion
Chr 17: 12909583 - 12910138
Public Clones XST197 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000245802 (Chr17:12910139..12910276 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAACTGCACGGTCCTTGAT Chr17:12910149..12910168 59.73 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000245802 (Chr17:12910139..12910276 -)
Downstram Exon
ENSMUSE00000135672 (Chr17:12909435..12909582 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAACTGCACGGTCCTTGAT Chr17:12910149..12910168 59.73 50 TGCACCATTCTTCTTCGTGA Chr17:12909517..12909536 60.39 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000402412 Chr17:12962266..12962530 CCTGGCTCCAGTTCTCTCTC Chr17:12962510..12962529 59.13 60
upstream ENSMUSE00000416277 Chr17:12941510..12941649 CAACGTCTGTGGAAATGTGG Chr17:12941582..12941601 60 50
upstream ENSMUSE00000468080 Chr17:12933148..12933272 CAGCCTTCAGATTCACAGCA Chr17:12933191..12933210 60.14 50
upstream ENSMUSE00000135694 Chr17:12932153..12932251 GCAGCCTGCAAGAAAGACATA Chr17:12932171..12932191 60.54 47.62
upstream ENSMUSE00000135700 Chr17:12928833..12928965 ACCATGCTATGCATTTGATGAC Chr17:12928942..12928963 59.86 40.91
upstream ENSMUSE00000135665 Chr17:12926663..12926792 CTGAAGCTGTTGAGCAAGGA Chr17:12926666..12926685 59.31 50
upstream ENSMUSE00000135675 Chr17:12924274..12924379 CAGCCCTGCAGTGACAGTAA Chr17:12924303..12924322 60.05 55
upstream ENSMUSE00000135698 Chr17:12919537..12919699 CCAAGTCCAACTGCCGTTAT Chr17:12919658..12919677 59.99 50
upstream ENSMUSE00000135676 Chr17:12919056..12919221 AGAAAAAGGCGGATTCCACT Chr17:12919097..12919116 60.07 45
upstream ENSMUSE00000135669 Chr17:12918181..12918284 TGGAGACCTCACCCTCATCT Chr17:12918256..12918275 59.64 55
upstream ENSMUSE00000135691 Chr17:12914994..12915158 TCTGTGTTGGCTCGTCACTC Chr17:12914996..12915015 60.03 55
upstream ENSMUSE00000135674 Chr17:12912679..12912816 AGCCAGGCAGAATCAGAAAA Chr17:12912765..12912784 59.96 45
upstream ENSMUSE00000135679 Chr17:12911518..12911661 No primer for this exon
upstream ENSMUSE00000245802 Chr17:12910139..12910276 AGAACTGCACGGTCCTTGAT Chr17:12910149..12910168 59.73 50

*** Putative Vector Insertion (Chr 17: 12909583 - 12910138) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000135672 Chr17:12909435..12909582 TGCACCATTCTTCTTCGTGA Chr17:12909517..12909536 60.39 45
downstream ENSMUSE00000135704 Chr17:12908739..12908913 GAGTGCCGTTCCTGTAGCTC Chr17:12908806..12908825 60.02 60
downstream ENSMUSE00000135685 Chr17:12908244..12908359 AACTGGTGTACCACCGGAAG Chr17:12908295..12908314 59.88 55
downstream ENSMUSE00000135682 Chr17:12907739..12907907 AACATGTTCCCGGGAGTTTT Chr17:12907819..12907838 60.59 45
downstream ENSMUSE00000135681 Chr17:12906827..12907006 CAAGCAGAGCCGTTCACATA Chr17:12906875..12906894 60.01 50
downstream ENSMUSE00000135703 Chr17:12904885..12904986 TGACCACACATTCCCAGTTG Chr17:12904922..12904941 60.42 50
downstream ENSMUSE00000135660 Chr17:12903503..12903607 TGAGCAGAATCGTTGAGTGG Chr17:12903518..12903537 59.98 50
downstream ENSMUSE00000135688 Chr17:12902245..12902440 CAGGCATTGCACCACAGATA Chr17:12902394..12902413 60.69 50
downstream ENSMUSE00000245636 Chr17:12898554..12898718 CGTGTGGAGTCAATGTCCTG Chr17:12898609..12898628 60.15 55
downstream ENSMUSE00000245617 Chr17:12897763..12897906 GGCGCTCAAGTCATACTCGT Chr17:12897853..12897872 60.43 55
downstream ENSMUSE00000135709 Chr17:12897499..12897674 TCTGTCCCCATTCACGTACA Chr17:12897531..12897550 59.96 50
downstream ENSMUSE00000135663 Chr17:12897138..12897225 TGTTCGCCACACAAACACAT Chr17:12897147..12897166 61.04 45
downstream ENSMUSE00000135656 Chr17:12896227..12896442 GCAGACCCGCAAGTAGTAGG Chr17:12896305..12896324 59.9 60
downstream ENSMUSE00000135684 Chr17:12895063..12895193 GTCCGTTTTCGAAAGTCAGC Chr17:12895136..12895155 59.86 50
downstream ENSMUSE00000245461 Chr17:12894799..12894896 TGTGTTCGCCACTCAAACAT Chr17:12894819..12894838 60.16 45
downstream ENSMUSE00000245427 Chr17:12894086..12894222 ACAGCCTCCCAGTTGTCACT Chr17:12894135..12894154 59.76 55
downstream ENSMUSE00000135707 Chr17:12893208..12893398 CACTGCAGGTGAAGCGAATA Chr17:12893197..12893216 60.01 50
downstream ENSMUSE00000135708 Chr17:12892046..12892172 TCTTCACAGGACAGGCAGAA Chr17:12892066..12892085 59.54 50
downstream ENSMUSE00000135705 Chr17:12891391..12891510 TTCTCGCTGTAGGAGGCATT Chr17:12891425..12891444 59.98 50
downstream ENSMUSE00000135651 Chr17:12890952..12891208 GAGTGTGCACGTCTGCTTGT Chr17:12890969..12890988 60.1 55
downstream ENSMUSE00000135668 Chr17:12890191..12890409 CTTCCATTCCGCACAGTACA Chr17:12890362..12890381 59.72 50
downstream ENSMUSE00000135689 Chr17:12888152..12888301 TGTCGGCTAAGCAATGAGTG Chr17:12888186..12888205 60.01 50
downstream ENSMUSE00000135706 Chr17:12886869..12887030 TTCGTCAGGACAGACAATCG Chr17:12886931..12886950 59.83 50
downstream ENSMUSE00000135671 Chr17:12885940..12886147 TGCTGTGCACACCCCTATAC Chr17:12886081..12886100 59.6 55
downstream ENSMUSE00000135667 Chr17:12885505..12885651 CAGTTTCGCTCGTCCCTCTA Chr17:12885541..12885560 60.53 55
downstream ENSMUSE00000135673 Chr17:12884749..12884983 ACCTCACACCCACGATCTTC Chr17:12884865..12884884 59.97 55
downstream ENSMUSE00000135678 Chr17:12884023..12884159 CAGTCCAGGGGACCTTTGTA Chr17:12884090..12884109 59.96 55
downstream ENSMUSE00000135657 Chr17:12882998..12883112 CGCACAGGTCAATTCGATTA Chr17:12883005..12883024 59.69 45
downstream ENSMUSE00000135655 Chr17:12881856..12882002 CAGCCCGTGAGTACCAGTAAA Chr17:12881931..12881951 60.17 52.38
downstream ENSMUSE00000135677 Chr17:12881182..12881369 GCATGCAGGGTAAGAAGAGC Chr17:12881251..12881270 59.99 55
downstream ENSMUSE00000135687 Chr17:12879488..12879674 GATCCCATCCTTCACCAGAG Chr17:12879540..12879559 59.46 55
downstream ENSMUSE00000135699 Chr17:12878457..12878600 CGCTCTCATCCTCAAAGTCC Chr17:12878556..12878575 59.95 55
downstream ENSMUSE00000135666 Chr17:12878004..12878073 GCAGCTGGTCAGCTTGTTTA Chr17:12878021..12878040 59.22 50
downstream ENSMUSE00000371471 Chr17:12875279..12876992 GGCACCACGGAGTTAGATGT Chr17:12876542..12876561 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTTGTCTGGTGTGCATGA Chr17:12910096..12910116 59.26 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTTGTCTGGTGTGCATGA Chr17:12910096..12910116 59.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023830