Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9841
Trapped Gene
Atp5g3 (ENSMUSG00000018770)
Vector Insertion
Chr 2: 73747999 - 73749011
Public Clones XB857 (baygenomics) XB220 (baygenomics) XB515 (baygenomics) XB022 (baygenomics)
XB850 (baygenomics) XB078 (baygenomics) XB295 (baygenomics)
Private Clones OST321241 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000348390 (Chr2:73749012..73749117 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000348390 (Chr2:73749012..73749117 -)
Downstram Exon
ENSMUSE00000166095 (Chr2:73747921..73747998 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000388777 Chr2:73749309..73749360 No primer for this exon
upstream ENSMUSE00000690100 Chr2:73749299..73749382 No primer for this exon
upstream ENSMUSE00000348390 Chr2:73749012..73749117 No primer for this exon
upstream ENSMUSE00000709921 Chr2:73749012..73749117 No primer for this exon

*** Putative Vector Insertion (Chr 2: 73747999 - 73749011) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000166095 Chr2:73747921..73747998 No primer for this exon
downstream ENSMUSE00000166094 Chr2:73747241..73747434 No primer for this exon
downstream ENSMUSE00000383511 Chr2:73746506..73746764 No primer for this exon
downstream ENSMUSE00000690098 Chr2:73746504..73746764 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr2:73748941..73748961 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTCCGTGACTGGGAAAACC Chr2:73748944..73748965 63.21 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018770