Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9843
Trapped Gene
BC067068 (ENSMUSG00000036009)
Vector Insertion
Chr 10: 105270072 - 105278131
Public Clones XB323 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000499670 (Chr10:105278132..105278427 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCACACGGTGGACTTCTACA Chr10:105278240..105278259 59.75 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000499670 (Chr10:105278132..105278427 -)
Downstram Exon
ENSMUSE00000260066 (Chr10:105269907..105270071 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCACACGGTGGACTTCTACA Chr10:105278240..105278259 59.75 55 GGAGTGCACAGTCCCAAGTT Chr10:105269935..105269954 60.16 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000499670 Chr10:105278132..105278427 GCACACGGTGGACTTCTACA Chr10:105278240..105278259 59.75 55

*** Putative Vector Insertion (Chr 10: 105270072 - 105278131) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000260066 Chr10:105269907..105270071 GGAGTGCACAGTCCCAAGTT Chr10:105269935..105269954 60.16 55
downstream ENSMUSE00000260061 Chr10:105266904..105267010 TGACATTGCCTGAACCTCAT Chr10:105266924..105266943 59.09 45
downstream ENSMUSE00000260056 Chr10:105263054..105263647 TTCGATGGCATCAACAGGTA Chr10:105263188..105263207 60.07 45
downstream ENSMUSE00000415754 Chr10:105260216..105260366 TGCAGTCCCACCATTAAACA Chr10:105260322..105260341 59.96 45
downstream ENSMUSE00000415749 Chr10:105234281..105234375 AACCCCCAGTTTTCGTTAGC Chr10:105234329..105234348 60.35 50
downstream ENSMUSE00000415746 Chr10:105231418..105231447 No primer for this exon
downstream ENSMUSE00000415743 Chr10:105230396..105230469 No primer for this exon
downstream ENSMUSE00000363860 Chr10:105216644..105216737 No primer for this exon
downstream ENSMUSE00000397677 Chr10:105203020..105203094 No primer for this exon
downstream ENSMUSE00000364129 Chr10:105202276..105202347 GCAAGGAGCCAGAACAACTT Chr10:105202302..105202321 59.48 50
downstream ENSMUSE00000380997 Chr10:105200310..105200517 CAGAGCAATGACAGCGTAGC Chr10:105200418..105200437 59.77 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTACGTAGCCTACCTTCGTG Chr10:105278148..105278169 58.94 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTACGTAGCCTACCTTCGTG Chr10:105275148..105275169 58.94 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036009