Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9849
Trapped Gene
Gltscr1 (ENSMUSG00000070808)
Vector Insertion
Chr 7: 16572439 - 16572827
Public Clones XB432 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000637120 (Chr7:16572828..16574789 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCACACTCAACGGGAACTC Chr7:16574026..16574045 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000637120 (Chr7:16572828..16574789 -)
Downstram Exon
ENSMUSE00000599922 (Chr7:16572262..16572438 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCACACTCAACGGGAACTC Chr7:16574026..16574045 60.01 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677016 Chr7:16584743..16584844 CACCCTTCCCTTCATGATTC Chr7:16584756..16584775 59.34 50
upstream ENSMUSE00000677015 Chr7:16581900..16581945 ATGATGAGGATGGGAGATGC Chr7:16581917..16581936 59.85 50
upstream ENSMUSE00000637122 Chr7:16581750..16581792 TCAGGCCCTCAATGATTTCT Chr7:16581767..16581786 59.63 45
upstream ENSMUSE00000677014 Chr7:16578429..16578494 GCCCAAAGTGCCTTCTATGA Chr7:16578439..16578458 60.21 50
upstream ENSMUSE00000637120 Chr7:16572828..16574789 ACCACACTCAACGGGAACTC Chr7:16574026..16574045 60.01 55

*** Putative Vector Insertion (Chr 7: 16572439 - 16572827) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000599922 Chr7:16572262..16572438 No primer for this exon
downstream ENSMUSE00000599921 Chr7:16564700..16565335 GGATGACAAAGATGCCAGGT Chr7:16565061..16565080 59.93 50
downstream ENSMUSE00000599920 Chr7:16564364..16564544 GGAGTACCCCCAGCCTTATT Chr7:16564479..16564498 59.31 55
downstream ENSMUSE00000677013 Chr7:16564038..16564147 TTTCGGCAGGAAGTAGAGGA Chr7:16564099..16564118 59.95 50
downstream ENSMUSE00000677012 Chr7:16562400..16562461 TTCTTTGCTGGGTTGCAGTA Chr7:16562383..16562402 59.46 45
downstream ENSMUSE00000599917 Chr7:16561014..16561162 GTCTTGTAATCGGGGTGCAG Chr7:16561084..16561103 60.52 55
downstream ENSMUSE00000599916 Chr7:16560715..16560809 TTGAGCAGCTGCGTAGAGAC Chr7:16560748..16560767 59.49 55
downstream ENSMUSE00000599915 Chr7:16560432..16560534 TCTCCGCAGAAGGACTGACT Chr7:16560491..16560510 60.13 55
downstream ENSMUSE00000599914 Chr7:16556611..16558238 GGTGAGTGCACGTATGGATG Chr7:16556616..16556635 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr7:16572757..16572777 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGCTGACGTGACTGGGAAA Chr7:16572763..16572783 59.44 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070808