Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9855
Trapped Gene
Rrp9 (ENSMUSG00000041506)
Vector Insertion
Chr 9: 106379766 - 106380001
Public Clones XB465 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000261058 (Chr9:106379649..106379765 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTAGCGGCACCTTGAACAGT Chr9:106379659..106379678 60.32 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000261058 (Chr9:106379649..106379765 +)
Downstram Exon
ENSMUSE00000261040 (Chr9:106380002..106380084 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTAGCGGCACCTTGAACAGT Chr9:106379659..106379678 60.32 55 GCTCTCAGAATCGCTGGAAA Chr9:106380082..106380101 60.62 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000261058 Chr9:106379649..106379765 GTAGCGGCACCTTGAACAGT Chr9:106379659..106379678 60.32 55

*** Putative Vector Insertion (Chr 9: 106379766 - 106380001) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000261040 Chr9:106380002..106380084 GCTCTCAGAATCGCTGGAAA Chr9:106380082..106380101 60.62 50
downstream ENSMUSE00000261016 Chr9:106383027..106383136 TTCTTTTCCTGTGCGGTCTC Chr9:106383095..106383114 60.38 50
downstream ENSMUSE00000260999 Chr9:106383487..106383554 No primer for this exon
downstream ENSMUSE00000260972 Chr9:106383644..106383685 GACTTCTGCAACCTGCCTCT Chr9:106383675..106383694 59.6 55
downstream ENSMUSE00000260948 Chr9:106384091..106384217 TGACCAAGCACGTAATGGAG Chr9:106384163..106384182 59.72 50
downstream ENSMUSE00000260931 Chr9:106385243..106385367 CTTCCGCCCAGTCTCTACAC Chr9:106385268..106385287 59.87 60
downstream ENSMUSE00000260913 Chr9:106385450..106385542 CGTGAAGGTGTACAGGTGCT Chr9:106385524..106385543 58.8 55
downstream ENSMUSE00000260891 Chr9:106385888..106385988 TAGGAGTTCTCGGCTGCATT Chr9:106385979..106385998 59.98 50
downstream ENSMUSE00000260867 Chr9:106386078..106386212 GGTGGCCATAGAAGACAAGC Chr9:106386214..106386233 59.7 55
downstream ENSMUSE00000260836 Chr9:106386297..106386359 No primer for this exon
downstream ENSMUSE00000260801 Chr9:106386542..106386687 TACGGATGACACCCAGAAGG Chr9:106386656..106386675 60.91 55
downstream ENSMUSE00000260784 Chr9:106386771..106386850 CAGGGGGATGTCACAGAGAG Chr9:106386853..106386872 60.67 60
downstream ENSMUSE00000260762 Chr9:106387408..106387481 ACCAAGAAGTCCCCAGCACT Chr9:106387460..106387479 61.08 55
downstream ENSMUSE00000369217 Chr9:106387583..106387747 CCTCTTTGATCCTCCACCAC Chr9:106387614..106387633 59.51 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGCTCCTGGGAGAGCCTAA Chr9:106379800..106379820 59.17 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATCTAGCTCCTGGGAGAGC Chr9:106379796..106379816 58.17 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041506