Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9860
Trapped Gene
Gltscr2 (ENSMUSG00000041560)
Vector Insertion
Chr 7: 16530704 - 16531178
Public Clones XB481 (baygenomics) XA142 (baygenomics) E078G04 (ggtc)
Private Clones OST378334 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000354040 (Chr7:16531179..16531412 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGGTAACAGGGACGGTGAG Chr7:16531373..16531392 60.42 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000354040 (Chr7:16531179..16531412 -)
Downstram Exon
ENSMUSE00000361026 (Chr7:16530639..16530703 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGGTAACAGGGACGGTGAG Chr7:16531373..16531392 60.42 60 TGAATCCTGTGTCCACGAAG Chr7:16530626..16530645 59.68 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000354040 Chr7:16531179..16531412 GTGGTAACAGGGACGGTGAG Chr7:16531373..16531392 60.42 60

*** Putative Vector Insertion (Chr 7: 16530704 - 16531178) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000361026 Chr7:16530639..16530703 TGAATCCTGTGTCCACGAAG Chr7:16530626..16530645 59.68 50
downstream ENSMUSE00000244182 Chr7:16528138..16528246 TGATTCTCAAGGGCAAGGTC Chr7:16528140..16528159 60.19 50
downstream ENSMUSE00000244176 Chr7:16527524..16527723 GAAGGGTCGCTCAATGATGT Chr7:16527524..16527543 60.08 50
downstream ENSMUSE00000244168 Chr7:16527089..16527159 AATCAAAGGCGTGTCCAGAG Chr7:16527115..16527134 60.26 50
downstream ENSMUSE00000244162 Chr7:16525487..16525582 CTGCAGGAATCACCTCCACT Chr7:16525500..16525519 60.26 55
downstream ENSMUSE00000244153 Chr7:16525078..16525182 GCTCCAGCTTTTCTGCCTCT Chr7:16525097..16525116 61.17 55
downstream ENSMUSE00000244146 Chr7:16524803..16525003 CTGCTGCTCCGTCTTCTTCT Chr7:16524811..16524830 59.89 55
downstream ENSMUSE00000244230 Chr7:16524438..16524613 CGCAGCCTGAAAAGTTCTTG Chr7:16524530..16524549 61.07 50
downstream ENSMUSE00000244142 Chr7:16524260..16524326 ATCAATGTCAGGAGCCTGGT Chr7:16524283..16524302 59.53 50
downstream ENSMUSE00000244137 Chr7:16523701..16523777 GTTCTCGGGGCTCAATCATA Chr7:16523686..16523705 60.04 50
downstream ENSMUSE00000637136 Chr7:16523523..16523579 TCTCCACCAGCTTCACTTTG Chr7:16523523..16523542 59.01 50
downstream ENSMUSE00000677017 Chr7:16523187..16523238 CTCCGACATCTGCACAGCTA Chr7:16523193..16523212 60.16 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGACGTCCGGCTACAGGAG Chr7:16531188..16531208 61.73 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAAGACGTCCGGCTACAG Chr7:16531191..16531211 63.62 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TAACAGGGACGGTGAGAAGC Chr7:16531367..16531387 60.26 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TAACAGGGACGGTGAGAAGC Chr7:16531367..16531387 60.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041560