Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9872
Trapped Gene
Fbxl11 (ENSMUSG00000054611)
Vector Insertion
Chr 19: 4394893 - 4396310
Public Clones XB538 (baygenomics) IST14619B8 (tigm)
Private Clones OST404073 (lexicon) OST262814 (lexicon) OST138772 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000697145 (Chr19:4396311..4397077 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACGCGGAGTCTGTAAAAGC Chr19:4396484..4396503 60.02 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000697145 (Chr19:4396311..4397077 -)
Downstram Exon
ENSMUSE00000644473 (Chr19:4394792..4394892 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACGCGGAGTCTGTAAAAGC Chr19:4396484..4396503 60.02 55 TGGCTGTACCGAATCCTTTC Chr19:4394777..4394796 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000707032 Chr19:4397934..4398266 TGCTACTGCTACCGGTTCCT Chr19:4398064..4398083 59.9 55
upstream ENSMUSE00000697145 Chr19:4396311..4397077 GACGCGGAGTCTGTAAAAGC Chr19:4396484..4396503 60.02 55

*** Putative Vector Insertion (Chr 19: 4394893 - 4396310) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000644473 Chr19:4394792..4394892 TGGCTGTACCGAATCCTTTC Chr19:4394777..4394796 60.07 50
downstream ENSMUSE00000697124 Chr19:4365785..4365802 No primer for this exon
downstream ENSMUSE00000697123 Chr19:4365157..4365180 No primer for this exon
downstream ENSMUSE00000492259 Chr19:4362776..4362914 GGTTTGGAGCTTCTCTTCCA Chr19:4362797..4362816 59.4 50
downstream ENSMUSE00000499673 Chr19:4361977..4362055 CACCCCGCTGGATATACTCT Chr19:4362004..4362023 59.03 55
downstream ENSMUSE00000504496 Chr19:4361538..4361584 No primer for this exon
downstream ENSMUSE00000505490 Chr19:4356748..4356926 CATTGTGCCATGGTCATTTC Chr19:4356835..4356854 59.78 45
downstream ENSMUSE00000247776 Chr19:4352268..4352374 GCCTTGGCCACATGTTATCTA Chr19:4352313..4352333 59.97 47.62
downstream ENSMUSE00000247754 Chr19:4351737..4351830 AGCAGCCTCGAACACTCATT Chr19:4351780..4351799 60.02 50
downstream ENSMUSE00000247736 Chr19:4350177..4350330 GAGCTCAATTCGTTGGCAAT Chr19:4350186..4350205 60.22 45
downstream ENSMUSE00000247717 Chr19:4348646..4348761 TTAATTGCATGGGGATGTTG Chr19:4348653..4348672 59.23 40
downstream ENSMUSE00000247648 Chr19:4345518..4345644 GGATCGGTTGGTTATGCAGT Chr19:4345536..4345555 59.82 50
downstream ENSMUSE00000393203 Chr19:4342847..4343241 CCTGTGGGGACACACTTCTT Chr19:4342862..4342881 60 55
downstream ENSMUSE00000247594 Chr19:4331186..4331269 GGATCGCTACTGGCAAGTTC Chr19:4331216..4331235 59.84 55
downstream ENSMUSE00000247451 Chr19:4328953..4329222 GCTAAGCACTGTCGGAGGAC Chr19:4328932..4328951 60.02 60
downstream ENSMUSE00000247425 Chr19:4328128..4328259 CAGATGCAGCATTCCATGAG Chr19:4328137..4328156 60.38 50
downstream ENSMUSE00000487092 Chr19:4326809..4326898 CTTTGTCCGAGCTGTCTTCC Chr19:4326792..4326811 59.99 55
downstream ENSMUSE00000405455 Chr19:4324337..4325046 AGTTCTTTGCGGCTGAGGTA Chr19:4324354..4324373 60.01 50
downstream ENSMUSE00000247321 Chr19:4322387..4322550 CTGAGGTCGAGGCTTACTGG Chr19:4322418..4322437 60.01 60
downstream ENSMUSE00000247290 Chr19:4320898..4321056 CGAAGATCAAGGGTCCTGAG Chr19:4320941..4320960 59.8 55
downstream ENSMUSE00000338144 Chr19:4320152..4320367 GGAAGACCCGACAGCAGTTA Chr19:4320164..4320183 60.26 55
downstream ENSMUSE00000707031 Chr19:4317822..4319281 GCAGGCAATAACCTTGGTGT Chr19:4318897..4318916 60 50
downstream ENSMUSE00000323076 Chr19:4316170..4319281 GCAGGCAATAACCTTGGTGT Chr19:4318897..4318916 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGTTTGGTTCCCGGTTAAT Chr19:4396255..4396276 59.23 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAACAAAATCCTCGGTGAGAT Chr19:4396302..4396323 58.11 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATCTGACGGGTTCAAAATGG Chr19:4397051..4397071 59.79 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ATCTGACGGGTTCAAAATGG Chr19:4397051..4397071 59.79 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054611