Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9917
Trapped Gene
Mettl8 (ENSMUSG00000041975)
Vector Insertion
Chr 2: 70893427 - 70893585
Public Clones NPX499 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000601827 (Chr2:70893428..70893584 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGTCGCTTCACCTGTGTGT Chr2:70893546..70893565 59.79 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000601827 (Chr2:70893428..70893584 -)
Downstram Exon
ENSMUSE00000601832 (Chr2:70893428..70893640 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGTCGCTTCACCTGTGTGT Chr2:70893546..70893565 59.79 55 CACCCACCAAAGCTATCCAG Chr2:70893562..70893581 60.51 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000601827 Chr2:70893428..70893584 GTGTCGCTTCACCTGTGTGT Chr2:70893546..70893565 59.79 55
upstream ENSMUSE00000601832 Chr2:70893428..70893640 CACGCGGTAAACCTGGATAG Chr2:70893596..70893615 60.51 55

*** Putative Vector Insertion (Chr 2: 70893427 - 70893585) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000690718 Chr2:70889729..70889790 GCTTGATGGCAGGAAAATACA Chr2:70889715..70889735 60.09 42.86
downstream ENSMUSE00000718165 Chr2:70856277..70856431 AGTCGGCAAATGCAACTTCT Chr2:70856363..70856382 59.88 45
downstream ENSMUSE00000719871 Chr2:70856277..70856431 AGTCGGCAAATGCAACTTCT Chr2:70856363..70856382 59.88 45
downstream ENSMUSE00000721885 Chr2:70856277..70856431 AGTCGGCAAATGCAACTTCT Chr2:70856363..70856382 59.88 45
downstream ENSMUSE00000644624 Chr2:70831541..70831632 CTTGCTCTTCTGGAGCGACT Chr2:70831519..70831538 59.89 55
downstream ENSMUSE00000644627 Chr2:70831541..70831632 CTTGCTCTTCTGGAGCGACT Chr2:70831519..70831538 59.89 55
downstream ENSMUSE00000321262 Chr2:70819912..70820252 TACCAGGAAACGGCTCTGTC Chr2:70819916..70819935 60.26 55
downstream ENSMUSE00000450557 Chr2:70819912..70820024 TACCAGGAAACGGCTCTGTC Chr2:70819916..70819935 60.26 55
downstream ENSMUSE00000321284 Chr2:70818434..70818483 TGTTCAGGATTGGAAACACG Chr2:70818419..70818438 59.54 45
downstream ENSMUSE00000450552 Chr2:70818117..70818210 CCATGTCTGACGCTAAGCAA Chr2:70818109..70818128 60.01 50
downstream ENSMUSE00000321276 Chr2:70814131..70814194 AGGCAAAGTCGCAGCAGTAG Chr2:70814132..70814151 60.73 55
downstream ENSMUSE00000644621 Chr2:70814131..70814194 AGGCAAAGTCGCAGCAGTAG Chr2:70814132..70814151 60.73 55
downstream ENSMUSE00000321327 Chr2:70811310..70811449 GTAGGCTAAGCCGTCGTCAC Chr2:70811356..70811375 59.9 60
downstream ENSMUSE00000690694 Chr2:70811310..70811449 GTAGGCTAAGCCGTCGTCAC Chr2:70811356..70811375 59.9 60
downstream ENSMUSE00000402297 Chr2:70810265..70810390 TGGGGGCTGTGACATCTTAT Chr2:70810308..70810327 60.34 50
downstream ENSMUSE00000483608 Chr2:70805107..70805213 TTCCATGATCCCGAAACAAT Chr2:70805118..70805137 60.13 40
downstream ENSMUSE00000690700 Chr2:70805107..70805213 TTCCATGATCCCGAAACAAT Chr2:70805118..70805137 60.13 40
downstream ENSMUSE00000484375 Chr2:70804530..70804570 No primer for this exon
downstream ENSMUSE00000644626 Chr2:70804505..70804528 No primer for this exon
downstream ENSMUSE00000690698 Chr2:70804505..70804570 No primer for this exon
downstream ENSMUSE00000690713 Chr2:70804505..70804570 No primer for this exon
downstream ENSMUSE00000718271 Chr2:70804505..70804570 No primer for this exon
downstream ENSMUSE00000715980 Chr2:70803494..70803736 AATCCACACTCGGTGCATCT Chr2:70803602..70803621 60.54 50
downstream ENSMUSE00000566495 Chr2:70802855..70803736 CTGAGTTCCCCCAAGAACAA Chr2:70803134..70803153 60.08 50
downstream ENSMUSE00000690688 Chr2:70802622..70803736 CTGAGTTCCCCCAAGAACAA Chr2:70803134..70803153 60.08 50
downstream ENSMUSE00000690703 Chr2:70802622..70803736 CTGAGTTCCCCCAAGAACAA Chr2:70803134..70803153 60.08 50
downstream ENSMUSE00000690708 Chr2:70802622..70803736 CTGAGTTCCCCCAAGAACAA Chr2:70803134..70803153 60.08 50
downstream ENSMUSE00000690712 Chr2:70802618..70803736 CTGAGTTCCCCCAAGAACAA Chr2:70803134..70803153 60.08 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGTCCCAGGAAGCTAATCG Chr2:70893528..70893548 59.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATAGCTTTGGTGGGTGCTGT Chr2:70893578..70893598 59.62 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041975