Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9935
Trapped Gene
D130003B22Rik (ENSMUSG00000024459)
Vector Insertion
Chr 17: 37124876 - 37125449
Public Clones (sanger) (sanger) XC230 (baygenomics) IST11715E12HMF1 (tigm) IST12329G12 (tigm)
IST13065C6 (tigm) IST11816G7 (tigm) IST12516E1 (tigm) IST12422E6 (tigm)
Private Clones OST322889 (lexicon) OST299197 (lexicon) OST276675 (lexicon) OST267960 (lexicon)
OST216004 (lexicon) OST65250 (lexicon)
Severity of mutation (?) Insertion after 61% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696609 (Chr17:37125450..37125725 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCGCACATACCTGGAGAT Chr17:37125476..37125495 60.1 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696609 (Chr17:37125450..37125725 -)
Downstram Exon
ENSMUSE00000696606 (Chr17:37124600..37124875 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCGCACATACCTGGAGAT Chr17:37125476..37125495 60.1 55 CCTGCAGGTCTGGTCTCAAT Chr17:37124691..37124710 60.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696612 Chr17:37126374..37126449 CTGCGCTCTCTACCCTCCTA Chr17:37126420..37126439 59.73 60
upstream ENSMUSE00000696611 Chr17:37125880..37126149 TTCGTGGACGACACACAGTT Chr17:37126053..37126072 60.2 50
upstream ENSMUSE00000696609 Chr17:37125450..37125725 CTCCGCACATACCTGGAGAT Chr17:37125476..37125495 60.1 55

*** Putative Vector Insertion (Chr 17: 37124876 - 37125449) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000696606 Chr17:37124600..37124875 CCTGCAGGTCTGGTCTCAAT Chr17:37124691..37124710 60.26 55
downstream ENSMUSE00000696604 Chr17:37124361..37124468 GAAGCAGGCCAACAGTGATT Chr17:37124396..37124415 60.26 50
downstream ENSMUSE00000696602 Chr17:37121006..37122047 GAACAAGCATGTGGGAGGTT Chr17:37121169..37121188 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCGCACATACCTGGAGAT Chr17:37125474..37125494 60.1 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCGCACATACCTGGAGAT Chr17:37125474..37125494 60.1 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGATGGTAATCGCCTTGCAG Chr17:37125661..37125681 60.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAGGCTCTCACGTCTTTCAG Chr17:37125707..37125727 58.75 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024459