Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9937
Trapped Gene
Zfy1 (ENSMUSG00000053211)
Vector Insertion
Chr Y: 75587 - 96292
Public Clones (sanger) (sanger) (sanger) XD045 (baygenomics) XD005 (baygenomics)
IST14476E9 (tigm) IST14473G5 (tigm) IST14011H8 (tigm) IST13431H12 (tigm)
IST12949E2 (tigm) IST14100C7 (tigm) IST12143E6 (tigm) IST14148F3 (tigm)
IST13288G11 (tigm) IST10767G5 (tigm) IST14807H6 (tigm) IST14038C8 (tigm)
IST14433D6 (tigm) IST10991B8 (tigm) IST14362C3 (tigm) IST11584F2 (tigm)
IST14282D6 (tigm) IST12482B7 (tigm) IST13840F1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000434270 (ChrY:96293..96380 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGCCATGGATGAAGATGAA ChrY:96339..96358 60.43 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000434270 (ChrY:96293..96380 -)
Downstram Exon
ENSMUSE00000568766 (ChrY:75035..75586 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGCCATGGATGAAGATGAA ChrY:96339..96358 60.43 45 GGCATCCCACTGGAATCTAA ChrY:75069..75088 59.89 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000448975 ChrY:133718..133852 GAACGGAAAGACTGGTGAGC ChrY:133778..133797 59.85 55
upstream ENSMUSE00000448971 ChrY:133554..133619 CTTGTCGTCATTGCCTACCC ChrY:133569..133588 60.52 55
upstream ENSMUSE00000434270 ChrY:96293..96380 AGGCCATGGATGAAGATGAA ChrY:96339..96358 60.43 45

*** Putative Vector Insertion (Chr Y: 75587 - 96292) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000568766 ChrY:75035..75586 GGCATCCCACTGGAATCTAA ChrY:75069..75088 59.89 50
downstream ENSMUSE00000568762 ChrY:71462..71611 TGCTTTGCTAGGTTCATCCA ChrY:71570..71589 59.42 45
downstream ENSMUSE00000568758 ChrY:69371..69511 ACTCTGGGAACACGAATGCT ChrY:69399..69418 59.73 50
downstream ENSMUSE00000568756 ChrY:66057..66179 CATCCATCTGTTGCTCATGC ChrY:66086..66105 60.23 50
downstream ENSMUSE00000568754 ChrY:63952..64092 CAAGGCCACCAGACTCATCT ChrY:63993..64012 60.26 55
downstream ENSMUSE00000476086 ChrY:61650..63038 GCCTTTGTGTGAACGGAAAT ChrY:62275..62294 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAAATTGAATTGACCCCAGA ChrY:96320..96341 60.29 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGTTACGTGACTGGGAAAACC ChrY:93225..93247 59.91 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ACTGAAGGCCATGGATGAAG ChrY:90342..90362 60.07 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACTGAAGGCCATGGATGAAG ChrY:87342..87362 60.07 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053211