Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9951
Trapped Gene
Tanc1 (ENSMUSG00000035168)
Vector Insertion
Chr 2: 59609320 - 59610409
Public Clones XC358 (baygenomics) IST12352C11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000692273 (Chr2:59609189..59609319 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGACAAGGCTGGGATTTCT Chr2:59609239..59609258 59.67 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000692273 (Chr2:59609189..59609319 +)
Downstram Exon
ENSMUSE00000692272 (Chr2:59610410..59610596 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGACAAGGCTGGGATTTCT Chr2:59609239..59609258 59.67 45 TAATGGTCTCGCAGGGACTT Chr2:59610554..59610573 59.69 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692281 Chr2:59450099..59450253 No primer for this exon
upstream ENSMUSE00000566920 Chr2:59450101..59450253 No primer for this exon
upstream ENSMUSE00000489031 Chr2:59484826..59484929 GACCACTGTACCGCGTTTCT Chr2:59484878..59484897 60.18 55
upstream ENSMUSE00000714716 Chr2:59537405..59537484 TGAAAATGCTGAAGGCTGTG Chr2:59537419..59537438 59.99 45
upstream ENSMUSE00000715765 Chr2:59537405..59537484 TGAAAATGCTGAAGGCTGTG Chr2:59537419..59537438 59.99 45
upstream ENSMUSE00000495924 Chr2:59562718..59562906 CTTTGCTGCCTCGACAATCT Chr2:59562850..59562869 60.54 50
upstream ENSMUSE00000692278 Chr2:59562718..59562906 CTTTGCTGCCTCGACAATCT Chr2:59562850..59562869 60.54 50
upstream ENSMUSE00000433766 Chr2:59580859..59580989 CTTCATTCTCGGCAGTGACA Chr2:59580949..59580968 59.98 50
upstream ENSMUSE00000566918 Chr2:59596522..59596626 TATGATCCCGTTCGGAGAAG Chr2:59596577..59596596 60.03 50
upstream ENSMUSE00000709162 Chr2:59596522..59596626 TATGATCCCGTTCGGAGAAG Chr2:59596577..59596596 60.03 50
upstream ENSMUSE00000718091 Chr2:59596522..59596626 TATGATCCCGTTCGGAGAAG Chr2:59596577..59596596 60.03 50
upstream ENSMUSE00000355162 Chr2:59609189..59609319 TTGACAAGGCTGGGATTTCT Chr2:59609239..59609258 59.67 45
upstream ENSMUSE00000692273 Chr2:59609189..59609319 TTGACAAGGCTGGGATTTCT Chr2:59609239..59609258 59.67 45

*** Putative Vector Insertion (Chr 2: 59609320 - 59610409) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000411253 Chr2:59610410..59610596 TAATGGTCTCGCAGGGACTT Chr2:59610554..59610573 59.69 50
downstream ENSMUSE00000692272 Chr2:59610410..59610596 TAATGGTCTCGCAGGGACTT Chr2:59610554..59610573 59.69 50
downstream ENSMUSE00000251466 Chr2:59623381..59623644 CCACTCCGGTCATCATTTTC Chr2:59623423..59623442 60.32 50
downstream ENSMUSE00000692271 Chr2:59623381..59623644 CCACTCCGGTCATCATTTTC Chr2:59623423..59623442 60.32 50
downstream ENSMUSE00000251459 Chr2:59628833..59628955 GTATTGTGCCAGGGCAATCT Chr2:59628929..59628948 59.96 50
downstream ENSMUSE00000692270 Chr2:59628833..59628934 GTATTGTGCCAGGGCAATCT Chr2:59628929..59628948 59.96 50
downstream ENSMUSE00000251452 Chr2:59629656..59629937 GGTGACAAACTGGGACTGCT Chr2:59629935..59629954 60.16 55
downstream ENSMUSE00000692269 Chr2:59629656..59629937 GGTGACAAACTGGGACTGCT Chr2:59629935..59629954 60.16 55
downstream ENSMUSE00000251446 Chr2:59631153..59631304 CTCTCTCGGTCTCTGGCTGT Chr2:59631280..59631299 59.73 60
downstream ENSMUSE00000692268 Chr2:59631153..59631304 CTCTCTCGGTCTCTGGCTGT Chr2:59631280..59631299 59.73 60
downstream ENSMUSE00000251441 Chr2:59633852..59634083 AGGCTTGTAAGTGGCTCCAG Chr2:59634078..59634097 59.5 55
downstream ENSMUSE00000251435 Chr2:59635643..59635809 TCACGGTCACGATCAACTTC Chr2:59635798..59635817 59.68 50
downstream ENSMUSE00000251425 Chr2:59637628..59638235 CCATTCAGGGAGATGTTGCT Chr2:59637773..59637792 60.07 50
downstream ENSMUSE00000251417 Chr2:59644333..59644441 CCAGTAGAGCGTGTCCGTTC Chr2:59644355..59644374 60.85 60
downstream ENSMUSE00000251410 Chr2:59645624..59645746 TCTGTGCTGTAACCGATCCA Chr2:59645694..59645713 60.26 50
downstream ENSMUSE00000251405 Chr2:59653375..59653611 CCCCTTCTTGATGAGCAGAC Chr2:59653608..59653627 59.8 55
downstream ENSMUSE00000251400 Chr2:59655542..59655727 CACTGGCCCTTCTTATCCAA Chr2:59655573..59655592 60.07 50
downstream ENSMUSE00000333011 Chr2:59658264..59658342 GTTTCTCCCCACAACGTGTC Chr2:59658343..59658362 60.41 55
downstream ENSMUSE00000432881 Chr2:59658264..59659438 CCACACCACCATCTGTTCTG Chr2:59659168..59659187 60 55
downstream ENSMUSE00000251390 Chr2:59671193..59671326 CTCGCAGATCTCCACCTTTC Chr2:59671239..59671258 59.95 55
downstream ENSMUSE00000251386 Chr2:59672638..59672761 AGCCACCATGAGAGGTGTTC Chr2:59672718..59672737 60.12 55
downstream ENSMUSE00000251378 Chr2:59673449..59673624 AGTACGGCCGTTTTTGTCTG Chr2:59673588..59673607 60.17 50
downstream ENSMUSE00000251372 Chr2:59675143..59675275 TCTATCACGGCTCCCTTCTC Chr2:59675180..59675199 59.39 55
downstream ENSMUSE00000251364 Chr2:59677032..59677123 TCCTTCCTCTACCAATTTCTGC Chr2:59677109..59677130 59.72 45.46
downstream ENSMUSE00000251355 Chr2:59678996..59679142 AACTTCCGCAAGGCATACTG Chr2:59679051..59679070 60.27 50
downstream ENSMUSE00000251349 Chr2:59680067..59680167 TTGGGTTTCAATTCCAGAGC Chr2:59680122..59680141 60.05 45
downstream ENSMUSE00000432834 Chr2:59680752..59684206 GTGGGCTTCCGTACTGACAT Chr2:59682126..59682145 60 55
downstream ENSMUSE00000692265 Chr2:59680752..59683774 GTGGGCTTCCGTACTGACAT Chr2:59682126..59682145 60 55
downstream ENSMUSE00000645040 Chr2:59681296..59681325 No primer for this exon
downstream ENSMUSE00000645037 Chr2:59681374..59682180 GTGGGCTTCCGTACTGACAT Chr2:59682126..59682145 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGCCACACACATAACCATTG Chr2:59609281..59609301 60.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGCCACACACATAACCATTG Chr2:59609281..59609301 60.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035168