Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9957
Trapped Gene
Xpot (ENSMUSG00000034667)
Vector Insertion
Chr 10: 121052280 - 121053670
Public Clones XC420 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000665515 (Chr10:121053671..121053740 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACTGCTCTCATGGCTTCAG Chr10:121053677..121053696 59.73 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000665515 (Chr10:121053671..121053740 -)
Downstram Exon
ENSMUSE00000573639 (Chr10:121052047..121052279 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACTGCTCTCATGGCTTCAG Chr10:121053677..121053696 59.73 55 ATGAGGATCCGCAGGTACAG Chr10:121052088..121052107 60.1 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000665519 Chr10:121063161..121063372 GGAGGACTACAGCGACAAGG Chr10:121063256..121063275 59.87 60
upstream ENSMUSE00000665518 Chr10:121059914..121060047 CCAAATGCCGATTCAGACTT Chr10:121059924..121059943 60.07 45
upstream ENSMUSE00000665517 Chr10:121056149..121056231 AGAGGCTCTGGCACAGAAGA Chr10:121056156..121056175 60.28 55
upstream ENSMUSE00000665516 Chr10:121054188..121054244 TGACCACGTAAAGTTCTTCTGC Chr10:121054220..121054241 59.42 45.46
upstream ENSMUSE00000665515 Chr10:121053671..121053740 CACTGCTCTCATGGCTTCAG Chr10:121053677..121053696 59.73 55

*** Putative Vector Insertion (Chr 10: 121052280 - 121053670) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000573639 Chr10:121052047..121052279 ATGAGGATCCGCAGGTACAG Chr10:121052088..121052107 60.1 55
downstream ENSMUSE00000573638 Chr10:121050543..121050716 CGTAGGCCCCAACTACTTCA Chr10:121050558..121050577 60.12 55
downstream ENSMUSE00000573637 Chr10:121050279..121050447 AATGCTGAAAAACCCAGCAG Chr10:121050263..121050282 60.25 45
downstream ENSMUSE00000573636 Chr10:121048532..121048768 GAAAATCTGGCCACGAAGTC Chr10:121048715..121048734 59.68 50
downstream ENSMUSE00000573635 Chr10:121046753..121046791 AGCTTTTTGCTGATCCGAGA Chr10:121046740..121046759 60.1 45
downstream ENSMUSE00000573634 Chr10:121046180..121046242 No primer for this exon
downstream ENSMUSE00000521153 Chr10:121044567..121044691 ACTGAAGACCCTGCGAACAG Chr10:121044556..121044575 60.44 55
downstream ENSMUSE00000518249 Chr10:121044055..121044199 CAAAGCACTCGCTTTTGACA Chr10:121044051..121044070 60.17 45
downstream ENSMUSE00000573633 Chr10:121043777..121043896 CACAGACGTGTGCTGGTAGG Chr10:121043833..121043852 60.37 60
downstream ENSMUSE00000573632 Chr10:121043297..121043391 CTCCGGACTTTAGCACTGGA Chr10:121043317..121043336 60.39 55
downstream ENSMUSE00000573631 Chr10:121042638..121042707 CGGTGGAGAAAGGGCTAATA Chr10:121042616..121042635 59.18 50
downstream ENSMUSE00000573630 Chr10:121041402..121041640 GGCCGTTTCGTAAATGAAGA Chr10:121041559..121041578 60.07 45
downstream ENSMUSE00000442674 Chr10:121040085..121040370 TCTTTCGCCTCACAGTCCTT Chr10:121040112..121040131 59.99 50
downstream ENSMUSE00000240069 Chr10:121039287..121039476 CTGCAGGAAGGCGAAGTAAC Chr10:121039308..121039327 60.01 55
downstream ENSMUSE00000240059 Chr10:121038299..121038415 GTCAACGGCTCCTTGGATAA Chr10:121038341..121038360 60.07 50
downstream ENSMUSE00000240050 Chr10:121037848..121037963 CTTCAAAGGTGCCAGGAAAC Chr10:121037862..121037881 59.71 50
downstream ENSMUSE00000100791 Chr10:121036643..121036690 GTTTTCAGAGTCACGGCACA Chr10:121036637..121036656 59.88 50
downstream ENSMUSE00000100792 Chr10:121033240..121033311 CAACTTGTAGGGAGGGCAGAT Chr10:121033235..121033255 60.5 52.38
downstream ENSMUSE00000100790 Chr10:121030723..121030779 TTAGCATCAGGCTGCTGAAGT Chr10:121030723..121030743 60.17 47.62
downstream ENSMUSE00000639917 Chr10:121024436..121027276 ATCAAACCTTGGTGGCAGTC Chr10:121025680..121025699 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGGCTTCAGGCTCAGGTAA Chr10:121053665..121053685 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTTCAGGCTCAGGTAAAA Chr10:121053663..121053683 59.45 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034667