Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0319
Clone ID GC0319
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0319
Sequence
CAGGTCTCCAGATGGGTGCATGCTCCACTGTAGTGGTAGACGTGAGGATGGACTTGTCTCGTTCCCGCTCACGTTCCCGT
TCCCGC
Sequence Type mRNA
Unitrap ID UNI67

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125509252..125509337 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029478 (Ncor2) NM_011424 nuclear receptor co-repressor 2 Gene [Source:MGI (curated);Acc:Ncor2-002]

 
Come back to gene ENSMUSG00000029478


For any suggestions or comments, please send an email to unitrap@crg.es