Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST361013
Clone ID OST361013
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST361013
Sequence
GACTGAGGGGCAGATAAAAATAGCCAAGNAGGCGAGTTGTGATGGCATCCCTCTACTTGGGGACAGGACCTTTGGAACAG
GAACTGGTGGATTGTCTGGAAAGTTCTCTAGAAAAGTCACTCCAAGCGAAGTTTCCTTCCGACCTCAAGGTCTCCATTCT
CCTGGACTTCACCAGAGGCTCAAGAGGTAGGAAGAACTCTCGCACTATGCTGCTCCCACTCCTGCAGAGGTTTCCAGAGC
GCGTGCGCGTCTCCCTCTTCCACACACCAAACCTCCGAGGACTCCTCCGACTCCTTATCCCTGAGCGCTTCAATGAGACC
ATCGGCCTCCAGCACATCAAGGTGTACCTCTTTGACAACAACGTCATCCTGAGTGGTGCAAACCTGAGTGACTCATACTT
CACCAACCGCCAGGACCGCTACGTGTTCTTGCAGGACTGCGCTGAGATTGCCGACTTCTTCACAGAGCTGGTGGACGCCG
TGGGGGATGTATCCTTGCAGTTGCAGGGCGACGACACAGC
Sequence Type mRNA
Unitrap ID UNI20476

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117861511..117864797 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017715 (Pgs1) NM_133757 phosphatidylglycerophosphate synthase 1 Gene [Source:MGI (curated);Acc:Pgs1-001]

 
Come back to gene ENSMUSG00000017715


For any suggestions or comments, please send an email to unitrap@crg.es