Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST360921
Clone ID OST360921
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST360921
Sequence
GACTGAGCCGCATATGCACTAGAACTTCTGTTTGACCAGCTGCATGAAGGTGCTAAAGCCCTGGACGTGGGATCTGGAAG
TGGAATCCTCACCGCCTGTTTTGCACGGATGGTTGGAAATAGTGGAAAAGTCATTGGAATTGATCACATTAAAGAACTAG
TAGATGACCTCAATAACCTAATGTCAAAAAGGATGACCCAATGCCTCCTGTCCTCGGGGCGAGTGCGGCTGGTGGTGGGT
GATGGAAGAATGGGATACGCTGAAGAAGCCCCTTACGACGCTATTCATGTGGGAGCTGCAGCCCCAGTTGTGCCCCANGC
ATTAATAGACCANTTAAAGCCTGNTGGAAGATTGATATTGCCAGTCG
Sequence Type mRNA
Unitrap ID UNI11200

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 7357978..7364225 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019795 (Pcmt1) NM_008786 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:97502]

 
Come back to gene ENSMUSG00000019795


For any suggestions or comments, please send an email to unitrap@crg.es