Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST360783
Clone ID OST360783
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST360783
Sequence
ACTGAGGAAGCTTATGTGCCTCATTTCTTACTCAGGATTACCAACTGCCAGTTCTTGATACAATGTTTATAAGGAAGAAA
TACAGAGGAAAAGATTTGGGGCTTCATATGCTGGAAGATTTTGTTGATTCCTTTACAGAAGATGCACTTGGCCTTACGGT
ACCCACCTGTCTTCTCTCATGTACACAGCGTTCCAAGCAATACTTTGAAAAGTATCCAGGAGATCATGAACTTCTTTGGG
AAGTTGAAGGTGTGGGTCACTGGCATCAGCGAGTACCAGTCACCCGAGCATTGCAGAGAGAGGCTATTAAAGCTACAGAT
GTTTCTCAATATGAAGCCACAAGACCTGNGTCTGGAGAATATGGTCTTGCTGCTGTACCAGAACATGAACCTGGACTGGA
CGACACTCAGTCTAGTGAGCTGCAGATCCATTCCCTAAAAGATGCCTTTGCTAGCACTTCTGAAGGTCCAGAAAAGACTC
CTGTTTCCACGCGTACTCGGAGCAGCCATCTAAAGCCTA
Sequence Type mRNA
Unitrap ID UNI9104

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97876907..97884114 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es