Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST360766
Clone ID OST360766
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST360766
Sequence
TGAGGCTGTTCGCTGCTACGAATCTCTAATCTTAAAAGCTGAAGGGAAAGTGGAGTCTGATTTCTTTTGTCAATTAGGTC
ACTTCAACCTCTTATTGGAAGATTATCCAAAAGCATTATCTGCATACCAGAGGTACTACAGTTTACAGTCTGATTACTGG
AAGAATGCTGCCTTTTTATATGGTCTTGGTTTGGTCTACTTCCATTACAATGCATTTCAGTGGGCTATTAAAGCATTTCA
GGAGGTGCTTTATGTCGATCCCAGCTTTTGTCGAGCCAAGGAAATTCATTTACGACTTGGGCTTATGTTCAAAGTGAACA
CAGACTATGAGTCTAGTTTAAAGGTAGGTTGTTGGAGTTTTTTCAAGATACAATGTCCTATTTCTGTGATTG
Sequence Type mRNA
Unitrap ID UNI20489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 17776282..17800051 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037369 (Utx) NM_009483 ubiquitously transcribed tetratricopeptide repeat gene, X chromosome Gene [Source:MGI (curated);Acc:Utx-001]

 
Come back to gene ENSMUSG00000037369


For any suggestions or comments, please send an email to unitrap@crg.es