Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AP0575
Clone ID AP0575
Vector pGT0lxr
Project sanger

Sequence tag AP0575
Sequence
GGTTGTGAGCTCTTCTAGATGGTTTTGGTTGTGAGCTCTTCTAGATGGTTTTGGTTGTGAGCTCTTCTAGATGGTTCTTT
TTTATTTTTTCCGTAGTTCCAGCACTTCTGCTCTTGCTTTTTGTTTTGTTTTCTGCGTAAACCTCTGGCCCACTCTCAAA
AGGCAAGATGTCCAGTCATGTCCCGGCGGATATGATTAATTTGCGCCTCATCTTGGTGAGTGGGAAGACGAAAGAGTTCC
TCTTCTCCCCAAACGACTCTGCCTCTGACATCGCAAAGCACGTGTATGACAACTGGCCCATGG
Sequence Type mRNA
Unitrap ID UNI3913

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 149323470..149363653 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001687 (Ubl3) NM_011908 ubiquitin-like 3 Gene [Source:MGI Symbol;Acc:MGI:1344373]

 
Come back to gene ENSMUSG00000001687


For any suggestions or comments, please send an email to unitrap@crg.es