Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST360412
Clone ID OST360412
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST360412
Sequence
TTTATACCCAGCTTACTGCATTGGCGGCGGCAGGCCTTACCACACAAACGGCCAGCAANCTATCAGTTAACACAANCTGC
GNCACTGNAGCAACAAGCTGCAGCTGTATTACANNAGCTGTATTNACANNCTAAGNAGGCCCTGTNTAGTGNGCANCAAC
AGTTGCAACAACCTCANCAGACCATTTTAACACAGAATACNAGGCTTGGGNAGTGGCTGAGCATGCCATTAAGAGGAACT
TGTTGGGGCTGGTGAGATGGCTCA
Sequence Type mRNA
Unitrap ID UNI20506

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62244972..62248294 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020074 (Ccar1) NM_026201 cell division cycle and apoptosis regulator 1 Gene [Source:MGI Symbol;Acc:MGI:1914750]

 
Come back to gene ENSMUSG00000020074


For any suggestions or comments, please send an email to unitrap@crg.es