Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST359493
Clone ID OST359493
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST359493
Sequence
GACTGAGAGTGTGCAGTGAAGCACTTGCCTATTTCATTACTGTGAACTCCGAGAGCCATCGGGAAGCATGGACGAGCCTC
CTGCTGCTACTTCTAACCAAAACCCTCAAGATAAGCGATGAAAAGTTCAAAGCACACGCTGTCAATGTACTACCCCTACC
TGTGTGAAATTATGCAGTTTGACCTGATCCCTGAGCTCCGAGCAGTTCTGCGAAAGTTCTTCCTGCGGATAGGCCTGGTG
TATAAGATATGGATTCCAGAAGAGCCGTCGCAAGTGCCAGCAGCACTGTCATCGACCTGGTAGCACTGGCTGCATGGCCA
CTGCTGTGGTTCTGTAGAACATCCGCCATGCCGTCCCAGCTGGCGGAGGGGGAGCTGCCCACCTAGCTGGGTTTGGACCT
GGAGTGCAGTGGGGTGAACCCTGGTCAGCACAGTCCCCAGCGGAGGCTCATGGTGTCTCATTAAACCATCACATACCAGT
AACTCGGTGGGCAGGGAGTCTGTTCCCCCGTCCTTTT
Sequence Type mRNA
Unitrap ID UNI10411

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166718999..166720500 387
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074582 (Arfgef2) NM_001085495 ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) Gene [Source:MGI (curated);Acc:Arfgef2-001]

 
Come back to gene ENSMUSG00000074582


For any suggestions or comments, please send an email to unitrap@crg.es