Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST359451
Clone ID OST359451
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST359451
Sequence
GTTCTGTTTTGAGGGGCTGGCCCTGTGCTTTCCTTTTGTACCTTAGGCAGCATAGCACCTGCCAGGCCTTAGAGGCCAGA
CCAATCTGGTCCATAGGAATTAAAAGCATTGATATGCCTACTAAAAAA
Sequence Type mRNA
Unitrap ID UNI20534

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 25428950..25429072 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036504 (Phpt1) NM_029293 phosphohistidine phosphatase 1 Gene [Source:MGI (curated);Acc:Phpt1-001]

 
Come back to gene ENSMUSG00000036504


For any suggestions or comments, please send an email to unitrap@crg.es