Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST359380
Clone ID OST359380
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST359380
Sequence
GACTGAGATCCGTCCAGAAAGTGCCCAGNAAGTAAACTTCCTCTTAGAAAAGCTGAAAACACAGTATTTATAACACTGGA
AATTGTAAAGAATTTGTTTAAAATGGCTGAAAACAATAGTAAAAATGTAGATGTATGGCCTAAAA
Sequence Type mRNA
Unitrap ID UNI285

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 47909187..47909327 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048379 (Socs4) NM_080843 suppressor of cytokine signaling 6 Gene [Source:MGI (curated);Acc:Socs4-001]

 
Come back to gene ENSMUSG00000048379


For any suggestions or comments, please send an email to unitrap@crg.es