Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST359374
Clone ID OST359374
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST359374
Sequence
AATCCTACTGCATTCGAATTTATACNCTAAAGGAGGATCANCCTCCAGGCTGAGTAACGGTGTCCCAGTCAAATATGTCT
GCCTTCTCTCAAGTTNTCTCTCACCCATCCATGGGAAGTCCTGCTACTGCTGGATTAGCACCAGGGAACAAGCTACCCTC
TGAGTCAGCACTGGACTTGAAGATAAATCCTACAGTTCATGAAACAGACTGATTCGACTAAAGNATGGATAGTTTGGGCA
GCGTTGGACAGCTCTATGAGGGGTCTGTTTGTTTAACTGGAGGGATTGTTGAGTTCAGCAACTTTTAACTCCCCCAATGA
CANGGGGTTGCNTGNTGTGAAAACAGGGTTTGAGAAGGAATCAATTTTTGGCAATTAATCAATATTCTTATTGACTCTGT
TTTCATTTAATCACAAAACTTCATAAAATAATTTTGTANAATGANAAACTGAAAAAAGGAGTCACCAAAT
Sequence Type mRNA
Unitrap ID UNI20540

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 148299693..148314970 289
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029647 (Pan3) NM_028291 PAN3 polyA specific ribonuclease subunit homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1919837]

 
Come back to gene ENSMUSG00000029647


For any suggestions or comments, please send an email to unitrap@crg.es