Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST359314
Clone ID OST359314
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST359314
Sequence
ATTGAGGACACAATCACAAAGAAAGGCAGGTGGCGGGAGTGCACCACCATGTGACAGCATTGTTGTGGCCTACTATTTCT
GTGGGGAACCCATCCCCTACCGGACCCTGGTGAGGGGCCGTGCTGTCACCCTGGGCCAGTTCAAGGAGCTGCTAACCAAG
AAGGGGAGCTACAGATACTACTTTAAGAAAGTGAGTGATGAGTTTGACTGTGGTGTGGTATTTGAGGAAGTACGGGAGGA
TGAGGCCGNCTTGCCTGTCTTTGAAGAAAAGATCATCGGCANGGNGGAAAAGGTGGACTGAGCACTGGGCAGCACACCCG
GAGCACACCATCACTACTGTGCATTGNCATCAGNCAGGTGGNCAGCCTTGTCCTNAGGANCCTGGTGNGGGGAACAACAC
AAGAT
Sequence Type mRNA
Unitrap ID UNI20542

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26330882..26332110 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024182 (Axin1) NM_009733 axin 1 Gene [Source:MGI (curated);Acc:Axin1-001]

 
Come back to gene ENSMUSG00000024182


For any suggestions or comments, please send an email to unitrap@crg.es