Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST359299
Clone ID OST359299
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST359299
Sequence
GTTTGAGAGACAGTGGAGATCCTGTTGTTCCTCAGTGCCATTGTGATGATGAAGAACCGCAGATCCATCACTGTGGAGCA
ACATGTAGGCAACATCTTTATGTTTAGTAAAGTGGCCAACGCCATCCTTTTCTTCCGACTGGATATTCGAATGGGTCTGC
TATACCTCACACTCTGCATAGTGTTCCTGATGACCTGCAAGCCCCCGCTGTACATGGGTCCTGAGTATATCAAGTACTTC
AATGATAAAACCATTGATGAGGAGCTGGAGCGAGACAAGAGGGTCACCTTGGATTGTGGAGTTCTTTGCCAACTGGTCTA
ATGATTGCCAATCCTTTGCTCCCATCTATGCGGACTTGTCCCTCAAGTACAACTGTTCAGGGCTAAATTTTGGGAAGGTA
GATGTTGGACGCTACACTGACGTTAGCACACGGTACAAAGTGAGCACATCACCCCTCACCAGACAGCTCCCTACCCTGAT
TCTGTTCCAAGGCGGCAAGGAGGTCATTCGTCGGATCGTAGATTGACAAGAAAGGACGAGCTGTCT
Sequence Type mRNA
Unitrap ID UNI20543

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84513198..84516315 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050043 (Txndc14) NM_025868 thioredoxin domain containing 14 Gene [Source:MGI (curated);Acc:Txndc14-001]

 
Come back to gene ENSMUSG00000050043


For any suggestions or comments, please send an email to unitrap@crg.es