Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AN0715
Clone ID AN0715
Vector pGT0lxr
Project sanger

Sequence tag AN0715
Sequence
TGACATAATTATTTATGATGTTGCTGACGATAATGTGGATGAAGAAAATATTCCAGTTATTCCAGAAACAAATGAGGATG
TTGTAGTGGATTCCTCCAACCAGTATCCTGACATTGTCATTGTTGAAGATGACAACGAGGATGAGTATGCTCCTGTCATT
CAGAGTGGAGAGCAGAGTGAACCAGCCAGAGAACCTTTACGTGTGGGGAGTGCTGGCAGCAGCAGCCCTGTCATGTCATG
TGCGTCCAGCAAACGGTTCTTCCAGTGTGACCTCAGAAGACCCTGTGACCATGATGGATTCCATTATGAATGACAACATT
AACTTGATAGGAAA
Sequence Type mRNA
Unitrap ID UNI4103

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 57224438..57225188 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019878 (Hsf2) NM_008297 heat shock factor 2 Gene [Source:MGI Symbol;Acc:MGI:96239]

 
Come back to gene ENSMUSG00000019878


For any suggestions or comments, please send an email to unitrap@crg.es