Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST358862
Clone ID OST358862
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST358862
Sequence
CTGAGTTTTTCGTAATNAGCTACCAAGGAACAACGCATTCTACTCCTATGAGCCCCCTTCTGAAACAGAAGCTTTGGGTA
CGGAATGTGTGTGCCTCCAGCTCAAGTCTGGAGCCCATCTCTGTCGGGTTTGTGGTTGCTTGGCCCCTATGACATGCTCT
AGGTGCAAACAGGCACATTACTGCAGCAAGGAGCATCAGACATTAGACTGGCGGCTGGGACACAAGCAGGCTTGTACACA
GTCAGACAAAATAGACCATATGGTTCCAGACCACAACTTCCTGTTTCCAGAATTTGAAATTGTAACAGAAACAGAAGATG
AAATTTTGCCTGAGGTTGTGGAAATGGAGGATTATTCTGAAGTTACAGGAAGCATGGGGGGAATTCCTGAGGAAGAACTA
GATTCCATGGCAAAGCACGAATCCAAGGAAGATCACATATTCCAAAAGTTTAAATCTAAAATAGCCCTTGAACCAGAGCA
GATTCTCAGGTATGGAAGAGGGATTAAACCCATCTGGCA
Sequence Type mRNA
Unitrap ID UNI20557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15662232..15663578 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014771 (Pdcd2) NM_008799 programmed cell death 2 Gene [Source:MGI Symbol;Acc:MGI:104643]

 
Come back to gene ENSMUSG00000014771


For any suggestions or comments, please send an email to unitrap@crg.es