Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST358583
Clone ID OST358583
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST358583
Sequence
CCTGTCATCTGAGCCTCCTCCACCGCCGCTGCAGCCCCCCACGCATCAGACTTCTGTAGGGCTATTGGATACCCCTCGCA
CCCGGGATCGCTCTCCATCCCCCCTGCGGGGCAATGTGGTCCCTAGCCCTCTGCCTACCCGCCGGACAAGGACCTTCTCA
GCGACAGTGCGGGCTTCGCAGGGCCCCGTCTACAAAGGAGTCTGTAAATGCTTCTGCCGGTCCAAGGGCCACGGCTTCAT
CACCCCAGCTGATGGTGGTCCTGACATCTTCCTGCACATCTCTGATGTGGAAGGGGAGTATGTTCCGGCGGAAGGC
Sequence Type mRNA
Unitrap ID UNI13542

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 8661166..8664507 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008393 (Carhsp1) NM_025821 calcium regulated heat stable protein 1 Gene [Source:MGI Symbol;Acc:MGI:1196368]

 
Come back to gene ENSMUSG00000008393


For any suggestions or comments, please send an email to unitrap@crg.es