Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST358516
Clone ID OST358516
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST358516
Sequence
GCAGAACCGAGACCGTGCGTGGTGGCAGGTCTTCCTCTTCCTTCAAAACCTCGCCCTGAACAGGCAAGAAAACAGGGAAG
GGGTGGGGCCCTGGTGAGGCTGGACCGCCCTGGCCGGATGGATCACCAGGAATGCAGTCTGGGAGGACAGAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16696

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 118358240..118358390 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040093 (Bmf) NM_138313 BCL2 modifying factor Gene [Source:MGI (curated);Acc:Bmf-001]

 
Come back to gene ENSMUSG00000040093


For any suggestions or comments, please send an email to unitrap@crg.es