Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST358509
Clone ID OST358509
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST358509
Sequence
GAGGTAACCTGGATAGGTGAGAGGAACTGCAGCTTGAAGGATTTAGTCACCTATGATGACGTGCATGTGAACTTCACTCA
GGAAGAGTGGGCTTTGCTGCATCCTTCTCAGACTGAGTCTCTACAAAGGTGTGATGCTAGAGACCTATAGGAATCTCACA
GCTATAGGTTACATTTGGGAAGAACATACAATTGAAGACCATTTCCAAACTTCTAGAAGTCATGGAAGGCATGAAAGAAG
TTGTTCTGCAGAGCAACCCCCTGAGTTTATTNAATGTGGTAAAGCCTTTGCATATGAGAGTGGTAGACAAAGGCATCAAA
TAAAACATACCTGGAGGGAAACANTGTNAAAANACAACCCTCAAAACCC
Sequence Type mRNA
Unitrap ID UNI3415

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177502742..177504405 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078864 (OTTMUSG00000016321) predicted gene, OTTMUSG00000016321 Gene [Source:MGI Symbol;Acc:MGI:3652185]

 
Come back to gene ENSMUSG00000078864


For any suggestions or comments, please send an email to unitrap@crg.es