Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AN0633
Clone ID AN0633
Vector pGT0lxr
Project sanger

Sequence tag AN0633
Sequence
TTTCCGGAGTATGCGCTGCTCCCGGTTCCGCCATTGCGGCTCTCCCGGCCCCTGGAGCCTCCGCCCCCGACCCAAGCTCT
CTCGTCTGCCTGCCAGTTCCCTGCGTCCCCGGAGAGTATCCCTNNGAGCCCAGCCTCCCCTCCCCTTCCCCGTCTCCTCC
TCTCCCTTGGAGAGCCCGGGCAGGCACTGCCCTGCAGCCCCAGTGACAGGAGGAGACCATACTCCCCGACAGCGCCATGG
CCCAGATTCTGCCCATTCGCTTTCAGGAGCATCTCCAG
Sequence Type mRNA
Unitrap ID UNI4112

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86570750..86571027 272
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047126 (Cltc) NM_001003908 clathrin, heavy polypeptide (Hc) Gene [Source:MGI (curated);Acc:Cltc-001]

 
Come back to gene ENSMUSG00000047126


For any suggestions or comments, please send an email to unitrap@crg.es