Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0329
Clone ID GC0329
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0329
Sequence
CTGAGGCAGAATTCATCAGCGTCTGGGGCACCGCTGGGCTGGCAGGCGCAGGCAACGTTCAGTTGCGAAAGCATGGCCTT
CCGGGGGCTCCTGCCATGTTGTTGTCTGATCGTTGTGATTTAAGAAGTATCTTTGACCAGAAGATGTCTTGGCCATCTCC
CAGCCTGCTGGCAGTGGTACATCATCAGGGATCTCAAAGGAGGACTGCCGGAGATGCTGAGCTGCAGGGGCAGCGGCAGG
GCCAGAGACAACNCCACTGNCTGTCAGTGTCCCAGGAGAAACGNTNTCCANNTGCAGGGAGGCTGGAGAGGACTGAGCTC
GAACANGCTGTNGAGNCANAG
Sequence Type mRNA
Unitrap ID UNI68

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7973796..8001679 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053110 (Yap1) NM_009534 yes-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:103262]

 
Come back to gene ENSMUSG00000053110


For any suggestions or comments, please send an email to unitrap@crg.es