Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AN0613
Clone ID AN0613
Vector pGT0lxr
Project sanger

Sequence tag AN0613
Sequence
AGGTCAAAGCCACACGCGGAGAAGAGAAGGACAAGGAGACCAAGAACGCAGCTAACGCCTCTGCATCCAAATCAGCGAAG
ACCGCAACGGCAGGACCAGGAACCACTAAGACAGCCAAGTCGTCCACTGTGCCTCCAGGCCTCCTTGTGTATTTGGACCT
GTGCTATATTCCCAACCACAGCAACAGTAAGAATGTTGATGTTGAGTTCTTCTAGAGAGTGAGGTCATCTTATTACGTGG
TGAGTGGGAACGACCTTACCGCGGAGGAGCCCAGCCGGGCTGTCCTGGATGCCTTGTTGGAAGGGAAGGCTCAGTGGGGA
AGCAACATGCAG
Sequence Type mRNA
Unitrap ID UNI4114

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 100197174..100199259 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052727 (Mtap1b) NM_008634 microtubule-associated protein 1B Gene [Source:MGI Symbol;Acc:MGI:1306778]

 
Come back to gene ENSMUSG00000052727


For any suggestions or comments, please send an email to unitrap@crg.es