Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST358272
Clone ID OST358272
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST358272
Sequence
AACTGAGTTTATCAGAGAAGATATGAAATATAAAGATGCTACGAATAAACATAGTCACCTGCACAGAGAAGATAAGCACA
TAACTGTTGAGGATTTGTGGAAACAGTGGAAAACATCAGAAGGTAANACTGNGCNGCTGCTCTGGAGCCTTGGCTTGTCT
GCTTCTGCCCTGCTTGGNNTTGGCAGCCCTACTAATTGCATATAATTATAGAGAAGATNATGCTTCATGTGAGAATATTT
ATATTTAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI20575

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 54466517..54466765 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039156 (Stim2) NM_001081103 stromal interaction molecule 2 Gene [Source:MGI (curated);Acc:Stim2-001]

 
Come back to gene ENSMUSG00000039156


For any suggestions or comments, please send an email to unitrap@crg.es