Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST358254
Clone ID OST358254
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST358254
Sequence
ACTGAGGACTGCAGCATCCGAGNNCAAAATAGACTTAGAGATCCGCATGCGAGAAGGAATATGGAAGCTGCTCTCGCTGA
GTACGAAAAAAGACCAAGTTTTGCATGCAGTTAAGAACCTCATGGTGTGCAGTGCTCGGATCCAGGCGTACACGGCGGAG
CCTGCAGAAGTCAAAAGAAGAGATTGCAAATCAAACCGGAGCACGGGT
Sequence Type mRNA
Unitrap ID UNI20577

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 67450053..67450252 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037846 (Rtkn2) NM_001081346 rhotekin 2 Gene [Source:MGI (curated);Acc:Rtkn2-001]

 
Come back to gene ENSMUSG00000037846


For any suggestions or comments, please send an email to unitrap@crg.es