Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST358219
Clone ID OST358219
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST358219
Sequence
ACTGAGGTTCCAGTGAGAAGTTGTGTAGAGCCCAACACGAACTTCACTTCCAAGCTGCCACCTATCTCTGCCTTTTGAGT
AGCATCCGGCAACATGTAGCCCTTCATCAGGAATTTCATGGCAAGGGTGAGCGTTCAGTGGAGGAGTCTGCTGGTTTAGT
GGGCCTCCAGTTGCCCCGTCAGCCTGGAGGGAAGGGCTGGGAGCCGTGATGCAGAGAGTCCTCAGATGTTCCTTCATTCA
AGAGTTTAACCATTTCTAACAATATGTAGTTATCATTAAATCTTTTTTAAAGTGTGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI12934

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 38489157..38489449 289
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019689 (1110001J03Rik) NM_025363 formation of mitochondrial complexes 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913367]

 
Come back to gene ENSMUSG00000019689


For any suggestions or comments, please send an email to unitrap@crg.es