Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST358118
Clone ID OST358118
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST358118
Sequence
CGTGACTCCCCTGGGNAACTGCCATGAAGCCTCAGAGGACTCCATACCGGTGAAGCGGCGCCCGGCGGGAGGACACTCAC
ATCTGCAACAAATGCTGTGCCGAGTTCTTTAGNCTCTCTGAATTCATGGAACACACCAGCCTTGGNTTTCTCACGCCCCG
TGAATGAATGTGTACGCCACAGTTTTACCTGCTGATACTGTAAGGTCTGAAAATAAAGNGAATGTTTTCCCTCCATGAAA
AAAAAA
Sequence Type mRNA
Unitrap ID UNI16162

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168573832..168582288 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]

 
Come back to gene ENSMUSG00000027547


For any suggestions or comments, please send an email to unitrap@crg.es