Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST358061
Clone ID OST358061
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST358061
Sequence
CAGAAGGAGGAGATGGGCATTTCCTGTGAGCTGCTGGAATCAGACTTCCTCAAGTGCAGTGTGGGATTTCCTTTCATGAG
GTCAAAGTCTAAGTATGAATTCAGNGTCATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAATTCTCAGCTTCATNG
NGACTGCTCAGAGTGGNAACTTGGANCGCTCTGAAGCCCTGCNTGACAACACTCTCACACTGACAGTGCCCCNTNGTGCA
TGAAGTGGACACGTTCCATCACTGGAATTGTGT
Sequence Type mRNA
Unitrap ID UNI20582

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 118741850..118750300 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039115 (Itga9) NM_133721 integrin alpha 9 Gene [Source:MGI Symbol;Acc:MGI:104756]

 
Come back to gene ENSMUSG00000039115


For any suggestions or comments, please send an email to unitrap@crg.es