Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AN0312
Clone ID AN0312
Vector pGT0lxr
Project sanger

Sequence tag AN0312
Sequence
GGAAGGGCGATCGGTGCGGGCCTNTTNGCTATTACACCAGCCTGCCATACTACACAGGGGTCCCGGGCTTTTGGGGGGGC
GGTTTTTTAAGGGGGTTTTTTTTTTTTTTTTTTTTCCTACCTCTTCCAAGCAGCATGGTGTGAATGTCAGTGTGAATGCC
TCGGCTACCCCTTTCCAACAGCCAAGTGGATATGGGTCTCATGGATACAACACTGGTGTGTCAGTCACCTCCAGTAACAC
GGGCGTGCCAGATATATCCGGTTTTGTGTACTCCAAAATCCCAG
Sequence Type mRNA
Unitrap ID UNI4126

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89807167..89813107 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042520 (Ubap2l) NM_028475 ubiquitin associated protein 2-like Gene [Source:MGI Symbol;Acc:MGI:1921633]

 
Come back to gene ENSMUSG00000042520


For any suggestions or comments, please send an email to unitrap@crg.es