Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AN0232
Clone ID AN0232
Vector pGT0lxr
Project sanger

Sequence tag AN0232
Sequence
CTCATCACAGCGTCCAGTGACTCAACGCTGAAGATCCTGGACCTGATGGAGGGCGGGCTGCTCTATACGTTCCATGGGCA
CCAGGGGCCTGCTACCACCGTTGCCTTTTCAAGAACGGGGGAGTATTTCGCTTCTGGAGGCTCCGATGAGCAGGTGATGG
TCNGGATGAGTAACTTGACATTGTTGATTATGGAAGCCCCCCACCCCTAGGCCCCCACCCCTAACCAGCTCTTTTGGAAG
TATGCCAAAAATGGATTAGCCTGTCCCACCAGGCAGAGACAGGAGTCTGGAGTCAGTTCAAGGCGAGCCCCAGGAGTCCA
TCAGCATGCCTCAGACANCGTTGCAGCACCCTGTAGCACATGGTGGTCCATTTTGGACATCCTCACGCAG
Sequence Type mRNA
Unitrap ID UNI4141

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106197522..106232347 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023345 (Wdr51a) NM_027354 WD repeat domain 51A Gene [Source:MGI Symbol;Acc:MGI:1917485]

 
Come back to gene ENSMUSG00000023345


For any suggestions or comments, please send an email to unitrap@crg.es