Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST356513
Clone ID OST356513
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST356513
Sequence
GACTGAGGACCTGAGACAGGAGGATCTTGAGTTGGAGTCCTGCCTGGGCATTATTGAAACCTGAAAGACCTGTTAAAAAC
TCTTTTCCAGCTGTAACCAAGATCCTCCGTGCTGGTCACCTGGACTTTTTGACAGGGTTTTAAGTTTACGTGCGTCTAGT
GTTTTTCCTCACTAATTAATTGTTAAGTAAGTAGTTTCCTGGTGTGTATGCCTTTTTTAGGGTTTTTCAATTAAAAGAGC
ACAGCAAGAATGTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI20623

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130386762..130387151 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025535 (4930579G22Rik) RIKEN cDNA 4930579G22 gene Gene [Source:MGI Symbol;Acc:MGI:1923099]

 
Come back to gene ENSMUSG00000025535


For any suggestions or comments, please send an email to unitrap@crg.es