Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST356500
Clone ID OST356500
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST356500
Sequence
TCGATTTTACCAGGACCTCAAAGACAGAGATGTCACATTTTCACCAGCCACTATTGAAGAAGAACTTATAAAGTTTTGCC
GTGAAGCAAGAGGCAAAGAGAATCGGTTGTGCTACTACATTGGAGCCACAGATGATGCTGCCACCAAGATCATCAATGAG
GTGTCGAAGCCCCTGGCCCACCATATCCCTGTGGAAAAGATCTGTGAGAAGCTGAAGAAGAAAGACAGCCAGATCTGTGA
ACTAAAATACGACAAGCAGATTGACCTGAGCACAGTGGACCTGAAGAAGCTCCGGGTGAAAGAGCTGAAGAAGATCCTGG
ACGACTGGGGGGGAGATGTGCAAAGGCTGTGCAGAAAAGTCTGACTATATCCGGAAGATAAATGAACTGATGCCTANATA
CGCCCCCAAGGCAGCCAG
Sequence Type mRNA
Unitrap ID UNI10898

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106791391..106793509 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032575 (Armet) NM_029103 arginine-rich, mutated in early stage tumors Gene [Source:MGI Symbol;Acc:MGI:1922090]

 
Come back to gene ENSMUSG00000032575


For any suggestions or comments, please send an email to unitrap@crg.es