Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST356419
Clone ID OST356419
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST356419
Sequence
AGCTGAGGGCACCGTTCTTTATCAACAAGACAAAGATTAAAGACTTTCCTCGATTCCCTCACCGGGGCGTACCTGCTGGA
TACATCTCGCCATTACCTGCCATTGTCTAGCATCCTGGATACACCTGGATGTCATGGCATACAATAAATTCAACGTGTTC
CACTGGCACTTGGTGGACGACTCTTCCTTCCCATATGAGAGCTTCACTTTCCCAGAGCTCACCAGAAAGGGGTCCTTCAA
CCCTGTCACTCACATCTACACAGCAGAG
Sequence Type mRNA
Unitrap ID UNI18855

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 59405090..59407169 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025232 (Hexa) NM_010421 hexosaminidase A Gene [Source:MGI Symbol;Acc:MGI:96073]

 
Come back to gene ENSMUSG00000025232


For any suggestions or comments, please send an email to unitrap@crg.es